Skip Navigation
Search

Neta Dean, Ph.D.

dean

Professor
Department of Biochemistry and Cell Biology

Life Sciences Building
Stony Brook University
Stony Brook, NY 11794-5215

Office telephone: 631-632-9309
E-mail:  Neta.Dean@stonybrook.edu

  • Research Description
      Protein glycosylation is an essential modification that functions in many biological roles ranging from the stabilization of protein structure to the regulation of cell surface properties. The N-linked oligosaccharides attached to proteins are the most common, most complex and most functionally diverse covalent modification that exist. Our research aims to understand how this modification is regulated, how glycoproteins mediate their biological roles at the cell surface, and how cell wall biosynthesis is coordinated with growth and division. As a model system for these studies, we use the budding yeast S. cerevisiae so that we can apply a combined genetic, biochemical, and cell biological approach to address these problems. Since cell surface carbohydrates are among the most important virulence determinants of pathogenic fungi, a major effort is also underway to understand the regulation of cell surface glycoprotein synthesis in the human fungal pathogen,  Candida albicans .
  • Selected Publications
    1. Henry Ng and Neta Dean (2017   Dramatic Improvement of CRISPR/Cas9 Editing in  Candida albicans  by Increased Single Guide RNA Expression.  mSphere vol 2;   http://msphere.asm.org/content/2/2/e00385-16
    2. Pelletreau, K.N., T. Andrews, N. Armstrong, M. A. Bedell, F. Dastoor,  N. Dean, S. Erster, C. FataHartley, N. Guild, H. Greig, D. Hall, J. K.  Knight, D. Koslowsky, P. P. Lemons, J. Martin, J. McCourt, J. Merrill,  R. Moscarella, R. Nehm, R. Northington, B. Olsen, L. Prevost, J.  Stoltzfus, M. Urban-Lurain, M. K. Smith. (2016).  A clicker-based case  study that untangles student thinking about the processes in the  central dogma.  CourseSource 3: 1-10 . [ pdf reprint]
    3. Li, ST., Wang, N, Xu, S, Yin. J. Nakanishi, H., Dean, N and Gao. 2016. Quantitative study of yeast Alg1 beta-1, 4 mannosyltransferase activity, a key enzyme involved in protein N-glycosylation. Biochimica et Biophysica Acta 1861 (2934–2941. [ pdf reprint]
    4. Dean, Neta. 2014. The Alg1, Alg2, and Alg11 Mannosyltransferases of the Endoplasmic Reticulum. In “Handbook of Glycosyltransferases and Related Genes” Taniguchi,N. et al. (eds) 2nd edition. Springer. pp 1239-1247 [ pdf reprint]
    5. Dean, N. and Gao, X. D. 2014 Heterodimeric Alg13/Alg14 UDP-GlcNAc Transferase (ALG13,14) In “Handbook of Glycosyltransferases and Related Genes” Taniguchi,N. et al. (eds) 2nd edition. Springer. pp 1231-1238 [ pdf reprint]
    6. Dean, N. and Gao, X. D. Dolichyl-phosphate (UDP-N-Acetylglucosamine) N- Acetylglucoseamine phospho-transferase 1( GlcNAc-1-P-transferase (DPAGT1). 2014 In “Handbook of Glycosyltransferases and Related Genes” Taniguchi,N. et al. (eds) 2nd edition. Springer. pp 1223-1230 [ pdf reprint]
    7. Douglas, LM, Wang, HX, Keppler-Ross,S, Dean, N, and Konopka. JB. 2011. Sur7 Promotes Plasma Membrane Organization and Is Needed for Resistance to Stressful Conditions and to the Invasive Growth and Virulence of Candida albicans MBio.;3(1) [ pdf reprint]
    8. Keppler-Ross S., Douglas L., Konopka J.B., and N. Dean. 2010. Recognition of yeast by murine macrophages requires mannan but not glucan.  Eukaryot Cell9; 1776-1787. [ pdf reprint]

    9. Noffz, C., Keppler-Ross, S. and N. Dean. 2009. Hetero-oligomeric interactions between early glycosyltransferases of the dolichol cycle  Glycobiology.  19:472-478 [ pdf reprint]
    10. Gao, X.D. , Moriyama, S., Mimura, N., Dean, N. and S. I. Nishimura 2008. Interaction between the C-termini of Alg13 and Alg14 mediate formation of the active UDP-N-acetylglucosamine transferase complex  J. Biol. Chem.  283: 32534-32541 [ pdf reprint]
    11. Averbeck, N., Gao, X. D., Nishimura, S. I. and Neta Dean. 2008. Proteasome degradation of the Alg13 ER UDP-GlcNAc glycosyltransferase catalytic subunit.  Molecular Biology of the Cell, 19; 2169-2178 [ pdf reprint]
    12. Keppler-Ross, S., Noffz, C. and N. Dean. 2008. A new purple fluorescent color marker for genetic studies in S. cerevisiae and C. albicans.  Genetics 179; 705-710 [ pdf reprint]
    13. Averbeck, N., Keppler-Ross, S., and N. Dean. 2007. Membrane topology of the Alg14 ER UDP-GlcNAc transferase subunit.  J. Biol. Chem. 282, 29081-29088 [ pdf reprint]
    14. Rida, P.C.G., Nishikawa, A., Won,G.Y. and N. Dean (2006) Yeast to hyphal transition triggers formin-dependent Golgi localization to the growing tip in  C. albicans Molecular Biology of the Cell  17: 4364-4378 [ pdf reprint]
    15. Gao, X. D., Tachikawa, H , Sato, T., Jigami, Y. and Neta Dean. 2005. Alg14 recruits Alg13 to the cytoplasmic face of the endoplasmic reticulum to form a novel bipartite UDP- N-acetylglucosamine transferase required for the second step of  N-linked glycosylation.  J. Biol. Chem.  280 : 36254-36262 [ pdf reprint]
    16. Gao, X. D., Wang, J., Keppler-Ross, S. and Neta Dean. 2005.  ERS1 encodes a functional homologue of the human lysosomal cystine transporter  FEBS J.  272: 2497–2511 [ pdf reprint]
    17. Gao, X. D., Nishikawa, A., and Neta Dean. 2004. Physical interactions between the Alg1, Alg2, and Alg11 mannosyltransferases of the endoplasmic reticulum Glycobiology  14: 559-570 (PDF 4) [ pdf reprint]
    18. Nishikawa, A., Mendez, B., Jigami, Y. and N. Dean. 2002. Identification of a  Candida glabrata homologue of the  S. cerevisiae VRG4 gene, encoding the Golgi GDP-mannose transporter.  Yeast  19:691-698 [ pdf reprint]
    19. Nishikawa, A., Poster, J. B. Jigami, Y. and N. Dean. 2002. Regulation of mannan biosynthesis in  C. albicans: Molecular and Ph enotypic Analysis of CaVRG4, Encoding an Essential Golgi Apparatus GDP-Mannose.  J. Bacteriol 184:29-42 [ pdf reprint]
    20. Cipollo , J. F, Trimble, R. B., Chi, J. H., Yan, Q., and N. Dean. 2001. The yeast  ALG11 gene specifies addition of the terminal a1,2-Man to the Man 5GlcNAc 2-PP-dolichol  N-glycosylation intermediate formed on the cytosolic side of the endoplasmic reticulum.  J. Biol. Chem.  276: 21828-21840 [ pdf reprint]
    21. Gao, X-D. and N. Dean. 2001. Identification of a conserved motif in the yeast Golgi GDP-mannose transporter required for binding to nucleotide sugar.  J. Biol. Chem . 276:  4424-4432 (PDF 8) [ pdf reprint]
    22. Gao, X-D. and N. Dean. 2000. Distinct protein domains of the yeast Golgi GDP-mannose transporter mediate oligomer assembly and export from the endoplasmic reticulum  J. Biol. Chem.  275:17718-17727 [ pdf reprint]
    23. Dean, N. 1999. Asparagine-linked glycosylation in the yeast Golgi.  Biochim. Biophys. Acta.  1426 (2,6):309-322 [ pdf reprint]
    24. Dean, N., Zhang, Y.B., and J. B. Poster. 1997. The yeast  VRG4 gene is required for GDP-mannose transport into the lumen of the Golgi in the yeast,  Saccharomyces cerevisiae.  J. Biol. Chem272;31908-31914 [ pdf reprint]
    25. Neiman, A. M., Mhaiskar, V., Manus, V., Galibert, F. and N. Dean. 1997  Saccharomyces cerevisiae  HOC1, a suppressor of  pkc1, encodes a putative glycosyltransferase. Genetics  145; 637-645 (PDF 12) [ pdf reprint]
    26. Chi, J.H., Roos, J, . and Dean, N. 1996 The  OST4 gene of  Saccharomyces cerevisiae encodes an unusually small protein required for normal levels of oligosaccharyltransferase activity  J. Biol. Chem.  271;3132-3140 [ pdf reprint]
    27. Poster, J. B. and N. Dean (1996). The yeast  VRG4 gene is required for normal Golgi functions and defines a new family of related genes.  J. Biol. Chem.   271; 3837-3845 [ pdf reprint]
    28. Dean, N. and J. B. Poster.(1996) Molecular and phenotypic analysis of the S. cerevisae  MNN10 gene identifies a family of related glycosyltransferases.  Glycobiology 6(1);73-81 [ pdf reprint]
    29. Dean, N. (1995) Yeast glycosylation mutants are sensitive to aminoglycosides.  Proc. Natl. Acad. Sci.  92; 1287-1291 [ pdf reprint]
  • Lab Resources
     

    DNA sequence files

    yEmRFP -ORF

    ATGGTTTCAAAAGGTGAAGAAGATAATATGGCTATTATTAAAGAATTTATGA
    GATTTAAAGTTCATATGGAAGGTTCAGTTAATGGTCATGAATTTGAAATTGAA
    GGTGAAGGTGAAGGTAGACCATATGAAGGTACTCAAACTGCTAAATTGAAAG
    TTACTAAAGGTGGTCCATTACCATTTGCTTGGGATATTTTGTCACCACAATTT
    ATGTATGGTTCAAAAGCTTATGTTAAACATCCAGCTGATATTCCAGATTATTT
    AAAATTGTCATTTCCAGAAGGTTTTAAATGGGAAAGAGTTATGAATTTTGAA
    GATGGTGGTGTTGTTACTGTTACTCAAGATTCATCATTACAAGATGGTGAATT
    TATTTATAAAGTTAAATTGAGAGGTACTAATTTTCCATCAGATGGTCCAGTTA
    TGCAAAAAAAAACTATGGGTTGGGAAGCTTCATCAGAAAGAATGTATCCAGA
    AGATGGTGCTTTAAAAGGTGAAATTAAACAAAGATTGAAATTAAAAGATGGT
    GGTCATTATGATGCTGAAGTTAAAACTACTTATAAAGCTAAAAAACCAGTTC
    AATTACCAGGTGCTTATAATGTTAATATTAAATTGGATATTACTTCACATAAT
    GAAGATTATACTATTGTTGAACAATATGAAAGAGCTGAAGGTAGACATTCAA
    CTGGTGGTATGGATGAATTATATAAATAA

    pRS316 –GAP-yEmRFP

    tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccg
    ggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagat
    tgtactgagagtgcaccacgcttttcaattcaattcatcattttttttttattcttttttttgatttcggtttctttgaaatttttttgattcggtaat
    ctccgaacagaaggaagaacgaaggaaggagcacagacttagattggtatatatacgcatatgtagtgttgaagaaacatgaaa
    ttgcccagtattcttaacccaactgcacagaacaaaaacctgcaggaaacgaagataaatcatgtcgaaagctacatataaggaa
    cgtgctgctactcatcctagtcctgttgctgccaagctatttaatatcatgcacgaaaagcaaacaaacttgtgtgcttcattggatgt
    tcgtaccaccaaggaattactggagttagttgaagcattaggtcccaaaatttgtttactaaaaacacatgtggatatcttgactgatt
    tttccatggagggcacagttaagccgctaaaggcattatccgccaagtacaattttttactcttcgaagacagaaaatttgctgacat
    tggtaatacagtcaaattgcagtactctgcgggtgtatacagaatagcagaatgggcagacattacgaatgcacacggtgtggtg
    ggcccaggtattgttagcggtttgaagcaggcggcagaagaagtaacaaaggaacctagaggccttttgatgttagcagaattgt
    catgcaagggctccctatctactggagaatatactaagggtactgttgacattgcgaagagcgacaaagattttgttatcggctttat
    tgctcaaagagacatgggtggaagagatgaaggttacgattggttgattatgacacccggtgtgggtttagatgacaagggaga
    cgcattgggtcaacagtatagaaccgtggatgatgtggtctctacaggatctgacattattattgttggaagaggactatttgcaaa
    gggaagggatgctaaggtagagggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgcggccagcaaaa
    ctaaaaaactgtattataagtaaatgcatgtatactaaactcacaaattagagcttcaatttaattatatcagttattaccctgcggtgtg
    aaataccgcacagatgcgtaaggagaaaataccgcatcaggaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgtt
    aaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttg
    ttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcc
    cactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagccccc
    gatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggc
    gctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcgcgccat
    tcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaggggggatg
    tgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattgtaatacgac
    tcactatagggcgaattggagctccaccgcggtggcggccgctctagaactagtGGATCCGTTAGAATCATTT
    TGAATAAAAAACACGCTTTTTCAGTTCGAGTTTATCATTATCAATACTGCCAT
    TTCAAAGAATACGTAAATAATTAATAGTAGTGATTTTCCTAACTTTATTTAGT
    CAAAAAATTAGCCTTTTAATTCTGCTGTAACCCGTACATGCCCAAAATAGGG
    GGCGGGTTACACAGAATATATAACATCGTAGGTGTCTGGGTGAACAGTTTAT
    TCCTGGCATCCACTAAATATAATGGAGCCCGCTTTTTAAGCTGGCATCCAGAA
    AAAAAAAGAATCCCAGCACCAAAATATTGTTTTCTTCACCAACCATCAGTTC
    ATAGGTCCATTCTCTTAGCGCAACTACAGAGAACAGGGGCACAAACAGGCAA
    AAAACGGGCACAACCTCAATGGAGTGATGCAACCTGCCTGGAGTAAATGATG
    ACACAAGGCAATTGACCCACGCATGTATCTATCTCATTTTCTTACACCTTCTA
    TTACCTTCTGCTCTCTCTGATTTGGAAAAAGCTGAAAAAAAAGGTTGAAACC
    AGTTCCCTGAAATTATTCCCCTACTTGACTAATAAGTATATAAAGACGGTAGG
    TATTGATTGTAATTCTGTAAATCTATTTCTTAAACTTCTTAAATTCTACTTTTA
    TAGTTAGTCTTTTTTTTAGTTTTAAAACACCAAGAACTTAGTTTCGAATAAAC
    ACACATAAACAAACAAAgaattcATGGTTTCAAAAGGTGAAGAAGATAATATGG
    CTATTATTAAAGAATTTATGAGATTTAAAGTTCATATGGAAGGTTCAGTTAAT
    GGTCATGAATTTGAAATTGAAGGTGAAGGTGAAGGTAGACCATATGAAGGTA
    CTCAAACTGCTAAATTGAAAGTTACTAAAGGTGGTCCATTACCATTTGCTTGG
    GATATTTTGTCACCACAATTTATGTATGGTTCAAAAGCTTATGTTAAACATCC
    AGCTGATATTCCAGATTATTTAAAATTGTCATTTCCAGAAGGTTTTAAATGGG
    AAAGAGTTATGAATTTTGAAGATGGTGGTGTTGTTACTGTTACTCAAGATTCA
    TCATTACAAGATGGTGAATTTATTTATAAAGTTAAATTGAGAGGTACTAATTT
    TCCATCAGATGGTCCAGTTATGCAAAAAAAAACTATGGGTTGGGAAGCTTCA
    TCAGAAAGAATGTATCCAGAAGATGGTGCTTTAAAAGGTGAAATTAAACAAA
    GATTGAAATTAAAAGATGGTGGTCATTATGATGCTGAAGTTAAAACTACTTA
    TAAAGCTAAAAAACCAGTTCAATTACCAGGTGCTTATAATGTTAATATTAAAT
    TGGATATTACTTCACATAATGAAGATTATACTATTGTTGAACAATATGAAAGA
    GCTGAAGGTAGACATTCAACTGGTGGTATGGATGAATTATATAAATAAggtaccg
    ctcgagcagctgtgattgattgaGTCGACctcgagggggggcccggtacccagcttttgttccctttagtgagggttaattcc
    gagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacataggagccggaagcat
    aaagtgtaaagcctggggtgcctaatgagtgaggtaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacc
    tgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcac
    tgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcagg
    ggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttc
    cataggctcggcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagat
    accaggcgttcccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctccctt
    cgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcac
    gaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccac
    tggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacg
    gctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggc
    aaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatccttt
    gatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcac
    ctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagt
    gaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactgcccgtcgtgtagataactacgatacgggagggc
    ttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagcc
    ggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagta
    gttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagc
    tccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgaaaaaaagcggttagctccttcggtcctccgatcgttgtc
    agaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttc
    tgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggata
    ataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctg
    ttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaa
    caggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattga
    agcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttcc
    ccgaaaagtgccacctgggtccttttcatcacgtgctataaaaataattataatttaaattttttaatataaatatataaattaaaaatag
    aaagtaaaaaaagaaattaaagaaaaaatagtttttgttttccgaagatgtaaaagactctagggggatcgccaacaaatactacct
    tttatcttgctcttcctgctctcaggtattaatgccgaattgtttcatcttgtctgtgtagaagaccacacacgaaaatcctgtgattttac
    attttacttatcgttaatcgaatgtatatctatttaatctgcttttcttgtctaataaatatatatgtaaagtacgctttttgttgaaattttttaa
    acctttgtttatttttttttcttcattccgtaactcttctaccttctttatttactttctaaaatccaaatacaaaacataaaaataaataaacac
    agagtaaattcccaaattattccatcattaaaagatacgaggcgcgtgtaagttacaggcaagcgatccgtcctaagaaaccatta
    ttatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtc

    yEp-GAP-yEmRFP

    ggatccGTTAGAATCATTTTGAATAAAAAACACGCTTTTTCAGTTCGAGTTTATC
    ATTATCAATACTGCCATTTCAAAGAATACGTAAATAATTAATAGTAGTGATTT
    TCCTAACTTTATTTAGTCAAAAAATTAGCCTTTTAATTCTGCTGTAACCCGTAC
    ATGCCCAAAATAGGGGGCGGGTTACACAGAATATATAACATCGTAGGTGTCT
    GGGTGAACAGTTTATTCCTGGCATCCACTAAATATAATGGAGCCCGCTTTTTA
    AGCTGGCATCCAGAAAAAAAAAGAATCCCAGCACCAAAATATTGTTTTCTTC
    ACCAACCATCAGTTCATAGGTCCATTCTCTTAGCGCAACTACAGAGAACAGG
    GGCACAAACAGGCAAAAAACGGGCACAACCTCAATGGAGTGATGCAACCTG
    CCTGGAGTAAATGATGACACAAGGCAATTGACCCACGCATGTATCTATCTCA
    TTTTCTTACACCTTCTATTACCTTCTGCTCTCTCTGATTTGGAAAAAGCTGAAA
    AAAAAGGTTGAAACCAGTTCCCTGAAATTATTCCCCTACTTGACTAATAAGTA
    TATAAAGACGGTAGGTATTGATTGTAATTCTGTAAATCTATTTCTTAAACTTC
    TTAAATTCTACTTTTATAGTTAGTCTTTTTTTTAGTTTTAAAACACCAAGAACT
    TAGTTTCGAATAAACACACATAAACAAACAAAgaattcATGGTTTCAAAAGGTG
    AAGAAGATAATATGGCTATTATTAAAGAATTTATGAGATTTAAAGTTCATAT
    GGAAGGTTCAGTTAATGGTCATGAATTTGAAATTGAAGGTGAAGGTGAAGGT
    AGACCATATGAAGGTACTCAAACTGCTAAATTGAAAGTTACTAAAGGTGGTC
    CATTACCATTTGCTTGGGATATTTTGTCACCACAATTTATGTATGGTTCAAAA
    GCTTATGTTAAACATCCAGCTGATATTCCAGATTATTTAAAATTGTCATTTCC
    AGAAGGTTTTAAATGGGAAAGAGTTATGAATTTTGAAGATGGTGGTGTTGTT
    ACTGTTACTCAAGATTCATCATTACAAGATGGTGAATTTATTTATAAAGTTAA
    ATTGAGAGGTACTAATTTTCCATCAGATGGTCCAGTTATGCAAAAAAAAACT
    ATGGGTTGGGAAGCTTCATCAGAAAGAATGTATCCAGAAGATGGTGCTTTAA
    AAGGTGAAATTAAACAAAGATTGAAATTAAAAGATGGTGGTCATTATGATGC
    TGAAGTTAAAACTACTTATAAAGCTAAAAAACCAGTTCAATTACCAGGTGCT
    TATAATGTTAATATTAAATTGGATATTACTTCACATAATGAAGATTATACTAT
    TGTTGAACAATATGAAAGAGCTGAAGGTAGACATTCAACTGGTGGTATGGAT
    GAATTATATAAATAAggtaccgctcgagcagctgtgattgattgaGTCGACTTGGTTGAACACG
    TTGCCAAGGCTTAAGTGAATTTACTTTAAATCTTGCATTTAAATAAATTTTCTT
    TTTATAGCTTTATGACTTAGTTTCAATTTATATACTATTTTAATGACATTTTCG
    ATTCGGATCCctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaa
    tggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatagggtaataactgatataattaaattgaagctc
    taatttgtgagtttagtatacatgcatttacttataatacagttttttagttttgctggccgcatcttctcaaatatgcttcccagcctgctttt
    ctgtaacgttcaccctctaccttagcatcccttccctttgcaaatagtcctcttccaacaataataatgtcagatcctgtagagaccac
    atcatccacggttctatactgttgacccaatgcgtctcccttgtcatctaaacccacaccgggtgtcataatcaaccaatcgtaacct
    tcatctcttccacccatgtctctttgagcaataaagccgataacaaaatctttgtcgctcttcgcaatgtcaacagtacccttagtatat
    tctccagtagatagggagcccttgcatgacaattctgctaacatcaaaaggcctctaggttcctttgttacttcttctgccgcctgctt
    caaaccgctaacaatacctgggcccaccacaccgtgtgcattcgtaatgtctgcccattctgctattctgtatacacccgcagagta
    ctgcaatttgactgtattaccaatgtcagcaaattttctgtcttcgaagagtaaaaaattgtacttggcggataatgcctttagcggctt
    aactgtgccctccatggaaaaatcagtcaagatatccacatgtgtttttagtaaacaaattttgggacctaatgcttcaactaactcca
    gtaattccttggtggtacgaacatccaatgaagcacacaagtttgtttgcttttcgtgcatgatattaaatagcttggcagcaacagg
    actaggatgagtagcagcacgttccttatatgtagctttcgacatgatttatcttcgtttcggtttttgttctgtgcagttgggttaagaat
    actgggcaatttcatgtttcttcaacactacatatgcgtatatataccaatctaagtctgtgctccttccttcgttcttccttctgttcgga
    gattaccgaatcaaaaaaatttcaaagaaaccgaaatcaaaaaaaagaataaaaaaaaaatgatgaattgaaaagctcttgttacc
    catcattgaattttgaacatccgaacctgggagttttccctgaaacagatagtatatttgaacctgtataataatatatagtctagcgct
    ttacggaagacaatgtatgtatttcggttcctggagaaactattgcatctattgcataggtaatcttgcacgtcgcatccccggttcat
    tttctgcgtttccatcttgcacttcaatagcatatctttgttaacgaagcatctgtgcttcattttgtagaacaaaaatgcaacgcgaga
    gcgctaatttttcaaacaaagaatctgagctgcatttttacagaacagaaatgcaacgcgaaagcgctattttaccaacgaagaatc
    tgtgcttcatttttgtaaaacaaaaatgcaacgcgagagcgctaatttttcaaacaaagaatctgagctgcatttttacagaacagaa
    atgcaacgcgagagcgctattttaccaacaaagaatctatacttcttttttgttctacaaaaatgcatcccgagagcgctatttttctaa
    caaagcatcttagattactttttttctcctttgtgcgctctataatgcagtctcttgataactttttgcactgtaggtccgttaaggttagaa
    gaaggctactttggtgtctattttctcttccataaaaaaagcctgactccacttcccgcgtttactgattactagcgaagctgcgggtg
    cattttttcaagataaaggcatccccgattatattctataccgatgtggattgcgcatactttgtgaacagaaagtgatagcgttgatg
    attcttcattggtcagaaaattatgaacggtttcttctattttgtctctatatactacgtataggaaatgtttacattttcgtattgttttcgatt
    cactctatgaatagttcttactacaatttttttgtctaaagagtaatactagagataaacataaaaaatgtagaggtcgagtttagatgc
    aagttcaaggagcgaaaggtggatgggtaggttatatagggatatagcacagagatatatagcaaagagatacttttgagcaatg
    tttgtggaagcggtattcgcaatattttagtagctcgttacagtccggtgcgtttttggttttttgaaagtgcgtcttcagagcgcttttg
    gttttcaaaagcgctctgaagttcctatactttctagctagagaataggaacttcggaataggaacttcaaagcgtttccgaaaacg
    agcgcttccgaaaatgcaacgcgagctgcgcacatacagctcactgttcacgtcgcacctatatctgcgtgttgcctgtatatatat
    atacatgagaagaacggcatagtgcgtgtttatgcttaaatgcgttatggtgcactctcagtacaatctgctctgatgccgcatagtt
    aagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagct
    gtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacg
    cctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttg
    tttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtat
    gagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagta
    aaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgcc
    ccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaa
    ctcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagt
    aagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaagga
    gctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaac
    gacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttccc
    ggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgct
    gataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagtta
    tctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggt
    aactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgata
    atctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatc
    ctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaa
    ctctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttca
    agaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccg
    ggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttgga
    gcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcgga
    caggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagt
    cctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagca
    acgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtatt
    accgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga
    gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatc 

  • Links
  • People

      Current

      Henry Ng

      Henry Ng

       

      Optimization of CRISPR/Cas in  C. albicans 

      Gregory Chionchio

      Gregory Chionchio

       

        N -linked glycosylation in the yeast Golgi

      Justin DaSilva

      Justin DaSilva

       

        N -linked glycosylation in the yeast Golgi

      Part of the gang

      Part of the gang

       

       

      Janie Ou Yang-

      Janie Ou Yang-

       

        N -linked glycosylation in the yeast Golgi

      Past

      Clifton Bangaree

      Clifton Bangaree

       

       

      Sabine Keppler-Ross

      Sabine Keppler-Ross

       

       

      Qiao Lu

      Qiao Lu

       

       

      Yuemeng Mao

      Yuemeng Mao

       

       

      Gisella Geohagen

      Gisella Geohagen

       

       

      Christine Noffz and Yo

      Christine Noffz and Yo

       

       

 

Login to Edit